Кафедра нервових хвороб

Постійне посилання на фонд

https://repository.pdmu.edu.ua/handle/123456789/30

Переглянути

Перегляд Кафедра нервових хвороб за Ключові слова "-308 G/А однонуклеотидний поліморфізм"

Зараз показуємо 1 - 1 з 1
  • Ескіз недоступний
    Документ
    Однонуклеотидний поліморфізм -308 g/а гену фактору некрозу пухлини-α при нелакунарних інсультах у пацієнтів різних вагових категорій
    (2013) Дельва, Михайло Юрійович; Дельва, Михаил Юрьевич; Delva, M. Yu.
    Нами вивчений розподіл однонуклеотидного поліморфізму (ОНП) -308G/A гену фактору некрозу пухлини-α (TNF-α) у 33 пацієнтів з нормальною масою тіла та у 37 пацієнтів з абдомінальним ожирінням (АО) ІІ ст. В дослідження було включено пацієнтів з відносно однаковими показниками віку (від 56 до 65 років), клінічної важкості захворювання при госпіталізації (від 5 до 10 балів згідно шкали NIHSS), розмірів церебрального ураження (від 10 до 20 см3), без цукрового діабету та вираженої супутньої патології. В загальній популяції осіб з нелакунарними інсультами частота 308G та 308A алелей гену TNF-α складає 0,9 та 0,1, у пацієнтів з АО ІІ ст. – 0,92 та 0,08, а у пацієнтів з нормальною масою тіла – 0,88 та 0,12. Популяційна структура за ОНП -308G/A гену TNF-α у пацієнтів з нелакунарними інсультами не відхиляється від рівноваги Харді-Вайнберга. Частота генотипів за ОНП -308G/A гену TNF-α при нелакунарних інсультах суттєво не роз- різняється у пацієнтів різних вагових категорій. Не виявлено будь яких закономірностей в клінічному перебігу гострого періоду захворювання та частоті розвитку «інвалідизуючих» функціональних станів (за модифікованою шкалою Ренкіна>2) через 12 тижнів після нелакунарних інсультів у пацієнтів з нормальною масою тіла та з АО ІІ ст. в залежності від ОНП -308G/A гену TNF-α; Нами изучено распределение однонуклеотидного полиморфизма (ОНП) -308G/A гена фактора некроза опухоли-α (TNF-α) у 33 пациентов с нормальной массой тела и у 37 пациентов с абдоминальным ожирением (АО) ІІ ст. В исследование включены пациенты с относительно одинаковыми показателями возраста (от 56 до 65 лет), клинической тяжести заболевания при госпитализации (от 5 до 10 баллов по шкале NIHSS), размерами церебрального инфаркта (от 10 до 20 см3), не имеющие сахарного диабета и выраженной сопутствующей патологии. В общей популяции пациентов с нелакунарными инсультами частота 308G та 308A аллелей гена TNF-α составляет 0,9 и 0,1, у пациентов с АО ІІ ст. – 0,92 и 0,08, а у лиц с нормальной массой тела – 0,88 и 0,12. Популяционная структура по ОНП -308G/A гена TNF-α у пациентов с нелакунарными инсультами не отклоняется от равновесия Харди-Вайнберга. Частота генотипов по ОНП -308G/A гена TNF-α при нелакунарных инсультах существенно не отличается у пациентов разных весовых категорий. Не выявлено каких-либо закономерностей в клиническом течении острого периода заболевания и в частоте развития «инвалидизирующих» состояний (по модифицированной шкале Рэнкина>2) через 12 недель после нелакунарных инсультов у пациентов с нормальной массой тела и с АО ІІ ст. в зависимости от ОНП -308G/A гена TNF-α; In recent years in scientific literature has been emerged a lot of scientific reports which prove independent and significant influences of obesity on acute ischemic strokes and functional outcome. Among the key factors that may determine the clinical severity of stroke, great importance has the intensity of local and systemic post-ischemic inflammatory response. As known, tumor necrosis factor-α is one of the key regulators of postischemic inflammatory response intensity through the influence on the synthesis and secretion of acute-phase proteins, chemokines, adhesion cell molecules, etc. In recent years, a number of investigations had shown that the degree of increase in tumor necrosis factor-α concentration in patients with ischemic stroke is largely determined by genetic factors. Purpose of the study was to indentify the distribution of -308 G/A single nucleotid polymorphisms (SNP) of the tumor necrosis factor-α gene (TNF-α) (rs1800795) and to determine associations between this SNP and clinical features, as well as functional outcomes of non-lacunar strokes in patients of different weight categories. We examined 33 patients with normal body weight and in 37 patients with abdominal obesity (AO) II class. Nonlacunar stroke subtype was verified by neurovisualization. In the study it has been recruited patients of similar age (56 to 65 years), with the similar clinical disease severity on admission (5-10 points according to NIHS scale), with relatively similar cerebral lesion volumes (from 10 to 20 cm3), without diabetes mellitus and severe co-morbidity. Molecular genetic analysis was performed in a laboratory «Gentrees LTD» (Poltava). DNA was extracted from white blood cells. To amplify the fragment of TNF-α gene, which contains the polymorphic site 308 G/A, it had been used oligonucleotide primers – direct TNFA308F: GGGACACACAAGCATCAAGG and reverse TNFA308R: AATAGGTTTTGAGGGCCATG. Restriction materials were analyzed by electrophoresis in 6 % polyacrylamide gel in 1хТВЕ. As molecular weight marker it had been used DNA pUC19, which was hydrolysed by endonuclease MspI. Visualization of amplification and restriction products was performed by gel dyeing with ethidium bromide and photographing in ultraviolet light transilluminator. In the general population of patients with non-lacunar stroke the frequencies of 308G and 308A allele were 0.9 and 0. 1, in abdominally obese patients – 0. 92 and 0.08, and in normal body weight patients – 0. 88 and 0.12 (p>0.05). The distribution of genotypes in the general population of patients with non-lacunar stroke corresponds to the Hardy-Weinberg equilibrium (the actual distribution – G/G – 81.5 %, G/A – 17.1 %, A/A – 1.4 % versus theoretical distribution – G/G – 81.0 %, G/A – 18.0 %, A/A – 1.0 %, p>0.05). The genotype rates of SNP-308G/A TNF-α gene don’t differ in normal body weight (G/G – 75,8 %, G/A+A/A – 24. 2 %) and abdominally obese patients (G/G – 86,5 %, G/A+A/A – 13.5 %, p>0.05). There were no any patterns of clinical outcomes (according to NIHSS score) on 10th post-stroke day in normal weight patients (G/G – 4,0 ± 0,3 versus G/А+ А/А – 3,9 ± 0,4, p>0.05) as well as in patients with AO II class (G/G – 5,3 ± 0,3, G/А+ А/А versus 5,0 ± 0,5, p>0.05). Also there were no differences in «disabling» functional outcome rates (according to modified Rankin scale score>2) at hospital discharge and in 12 weeks after stroke depending on SNP -308 G/A gene TNF-α distribution.